For the questions below, be sure to write all oligonucleotide sequences 5’+3′. You are researching a…

For the questions below, be sure to write all oligonucleotide sequences 5’+3′. You are researching a rare human leukemia that is caused by a mutation in a small protein called Cdr (for Cell Division Regulator). It has been found that patients with this rare leukemia contain a mutation in the 5′ untranslated region of cdr. The mutation is a GỮA transition at nucleotide 7 of the transcript. Human Chromosome G7A 5′ (sense strand) sequence included in cdr transcript gtactgcctattatgcagtettataagaaactaggtgccatggccttgacaggttctattagacactgtcggttgggcagacataatgagtctctagttgatgggagacgaccacgctgtcagtaagtactttttgcettcttatgccgtaccgac DNA egae DNA aacuaggugce aug gee uug aca ggu ucu auu aga cac ugu cgg uug ggc aga cau aau gag ucu cua guu gau ggg aga ega cca cge ugu cag uaa quacuuuuu mRNA MAL TGS I RHC RLG RH NE SLV DG BR PRC – protein For convenience, the DNA sequence shown in the figure above is copied here as text: gtactgcctattatgcagtcttataagaaactaggtgccatggccttgacaggttctattagacactgtcggttggg cagacataatgagtctctagttgatgggagacgaccacgctgtcagtaagtactttttgccttcttatgccgtaccg ac CRISPR helps in editing the particular region of a gene ,so for creating a mutation of G to A.If we there is a protospacer of 5′ TAAACTAAGG 3′,we can use a spacer of 3′ ATTTGATTCC 5′ sequence. Each prospacer has PAM which is defined to that particular organism of virus so that it can be recognized by the Cas9.So here the protospacer is having a 5’AGG3′ sequence and likewise the spacer should also be having a specified sequence so that it should not be cleaved by Cas9. You successfully create your mutated cell line and find that it exhibits an increased growth rate. You want to measure this growth rate using the dNTP analog bromodeoxyuridine (BrdU). However, when you add BrdU to the culture, the cells growth slows back down. You would like to sequence the cdr gene to ensure that the G7+A mutation is intact, but first you must PCR amplify the entire sequence of cdr that is transcribed. 10. What primers will you use to generate the correct amplicon for sequencing? Forward: Reverse: Your sequencing shows that your cells reverted to the wildtype sequence in the cdr untranslated region. You attribute this to BrdU interactions. 11. Draw the interactions that would have allowed this: